Factor XII (F12) (NM_000505) Human 3' UTR Clone

CAT#: SC201624

3`UTR clone of coagulation factor XII (Hageman factor) (F12) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: F12
• Synonyms: HAE3; HAEX; HAF
• ACCN: NM_000505
• Insert Size: 149 bp
• Sequence Data:
  Insert Sequence

  >SC201624 3'UTR clone of NM_000505
  The sequence shown below is from the reference sequence of NM_000505. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAGCACACCGTTTCCTGATTGCTCAGGGACTCATCTTTCCCTCCTTGGTGATTCCGCAGTGAGAGAGTG
  GCTGGGGCATGGAAGGCAAGATTGTGTCCCATTCCCCCAGTGCGGCCAGCTCCGCGCCAGGATGGCGCAG
  GAACTCAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000505.3
• Summary: This gene encodes coagulation factor XII which circulates in blood as a zymogen. This single chain zymogen is converted to a two-chain serine protease with an heavy chain (alpha-factor XIIa) and a light chain. The heavy chain contains two fibronectin-type domains, two epidermal growth factor (EGF)-like domains, a kringle domain and a proline-rich domain, whereas the light chain contains only a catalytic domain. On activation, further cleavages takes place in the heavy chain, resulting in the production of beta-factor XIIa light chain and the alpha-factor XIIa light chain becomes beta-factor XIIa heavy chain. Prekallikrein is cleaved by factor XII to form kallikrein, which then cleaves factor XII first to alpha-factor XIIa and then to beta-factor XIIa. The active factor XIIa participates in the initiation of blood coagulation, fibrinolysis, and the generation of bradykinin and angiotensin. It activates coagulation factors VII and XI. Defects in this gene do not cause any clinical symptoms and the sole effect is that whole-blood clotting time is prolonged. [provided by RefSeq, Jul 2008]
• Locus ID: 2161