SCARA3 (NM_182826) Human 3' UTR Clone

CAT#: SC201726

3`UTR clone of scavenger receptor class A member 3 (SCARA3) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SCARA3
• Synonyms: APC7; CSR; CSR1; MSLR1; MSRL1
• ACCN: NM_182826
• Insert Size: 191
• Sequence Data:
  Insert Sequence

  >SC201726 3'UTR clone of NM_182826
  The sequence shown below is from the reference sequence of NM_182826. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCACCATCCTACGAGGTCACACTTTGTTTTCACATAATCGGATATGATATGAAGCCAGCCATAAAGCCCA
  GGATGACCAAGAATATAATTTGAAAATGAATTTGTTTACTATCCTTAATGGTAAGCATCACCTTAAGCAC
  ATATTATGCCTTGAGACACTAGCCAATTGTGGTACATGAAAATAATTTATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_182826.1
• Summary: This gene encodes a macrophage scavenger receptor-like protein. This protein has been shown to deplete reactive oxygen species, and thus play an important role in protecting cells from oxidative stress. The expression of this gene is induced by oxidative stress. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
• Locus ID: 51435