CCL14 (NM_032962) Human 3' UTR Clone

CAT#: SC201734

3`UTR clone of chemokine (C-C motif) ligand 14 (CCL14) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CCL14"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CCL14
Synonyms CC-1; CC-3; CKB1; HCC-1; HCC-1(1-74); HCC-1/HCC-3; HCC-3; MCIF; NCC-2; NCC2; SCYA14; SCYL2; SY14
ACCN NM_032962
Insert Size 166 bp
Sequence Data
>SC201734 3'UTR clone of NM_032962
The sequence shown below is from the reference sequence of NM_032962. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACAAGTGGGTCCAGGACTATATCAAGGACATGAAGGAGAACTGAGTGACCCAGAAGGGGTGGCGAAGGCA
CAGCTCAGAGACATAAAGAGAAGATGCCAAGGCCCCCTCCTCCACCCACCGCTAACTCTCAGCCCCAGTC
ACCCTCTTGGAGCTTCCCTGCTTTGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_032962.4
Summary 'This gene, chemokine (C-C motif) ligand 14, is one of several CC cytokine genes clustered on 17q11.2. The CC cytokines are secreted proteins characterized by two adjacent cysteines. The cytokine encoded by this gene induces changes in intracellular calcium concentration and enzyme release in monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Read-through transcripts are also expressed that include exons from the upstream cytokine gene, chemokine (C-C motif) ligand 15, and are represented as GeneID: 348249. [provided by RefSeq, Dec 2009]'
Locus ID 6358

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.