UROD (NM_000374) Human 3' UTR Clone

CAT#: SC201746

3`UTR clone of uroporphyrinogen decarboxylase (UROD) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UROD
• Synonyms: PCT; UPD
• ACCN: NM_000374
• Insert Size: 173 bp
• Sequence Data:
  Insert Sequence

  >SC201746 3'UTR clone of NM_000374
  The sequence shown below is from the reference sequence of NM_000374. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AACACTCACGTCTGCTTCGACAGAACTGAGTGTATACCTTTACCCTCAAGTACCACTAACACAGATGATT
  GATCGTTTCCAGGACAATAAAAGTTTCGGAGTTGAACTATTGTGTAGTTTTGTTTGTGAAAGATTGTGCC
  CATATCCTCAGTTCTTCTTAGCCTCTGCTCCTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000374.3
• Summary: 'This gene encodes an enzyme in the heme biosynthetic pathway. This enzyme is responsible for catalyzing the conversion of uroporphyrinogen to coproporphyrinogen through the removal of four carboxymethyl side chains. Mutations and deficiency in this enzyme are known to cause familial porphyria cutanea tarda and hepatoerythropoetic porphyria.[provided by RefSeq, Aug 2010]'
• Locus ID: 7389