Cytokeratin 14 (KRT14) (NM_000526) Human 3' UTR Clone

CAT#: SC201784

3`UTR clone of keratin 14 (KRT14) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KRT14
• Synonyms: CK14; EBS3; EBS4; K14; NFJ
• ACCN: NM_000526
• Insert Size: 158 bp
• Sequence Data:
  Insert Sequence

  >SC201784 3'UTR clone of NM_000526
  The sequence shown below is from the reference sequence of NM_000526. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGTCCTTCGCACCAAGAACTGAGGCTGCCCAGCCCCGCTCAGGCCTAGGAGGCCCCCCGTGTGGACACA
  GATCCCACTGGAAGATCCCCTCTCCTGCCCAAGCACTTCACAGCTGGACCCTGCTTCACCCTCACCCCCT
  CCTGGCAATCAATACAGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000526.4
• Summary: 'This gene encodes a member of the keratin family, the most diverse group of intermediate filaments. This gene product, a type I keratin, is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Mutations in the genes for these keratins are associated with epidermolysis bullosa simplex. At least one pseudogene has been identified at 17p12-p11. [provided by RefSeq, Jul 2008]'
• Locus ID: 3861