Apc6 (CDC16) (NM_003903) Human 3' UTR Clone

CAT#: SC201816

3`UTR clone of cell division cycle 16 homolog (S. cerevisiae) (CDC16) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CDC16"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CDC16
Synonyms ANAPC6; APC6; CDC16Hs; CUT9
ACCN NM_003903
Insert Size 168
Sequence Data
>SC201816 3'UTR clone of NM_003903
The sequence shown below is from the reference sequence of NM_003903. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGTCAGACCACAGCACGTGACTCCAGTCAGTGGTCCTGGTCCCACTGTCCCAGTGTAGGAACAGAGACC
CGCCTTAAGAGACTGGATCGCACACCTTTGCAACAGATGTGTTCTGATTCTCTGAACCTACAAAATAGTT
ATACATAGTGGAATAAAGAAGGTAAACC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003903.3
Summary The protein encoded by this gene functions as a protein ubiquitin ligase and is a component of the multiprotein APC complex. The APC complex is a cyclin degradation system that governs exit from mitosis by targeting cell cycle proteins for degredation by the 26S proteasome. Each component protein of the APC complex is highly conserved among eukaryotic organisms. This protein, and other APC complex proteins, contain a tetratricopeptide repeat (TPR) domain; a protein domain that is often involved in protein-protein interactions and the assembly of multiprotein complexes. Multiple alternatively spliced transcript variants, encoding distinct proteins, have been identified. [provided by RefSeq, Jan 2016]
Locus ID 8881

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.