HSD17B8 (NM_014234) Human 3' UTR Clone

CAT#: SC201842

3`UTR clone of hydroxysteroid (17-beta) dehydrogenase 8 (HSD17B8) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HSD17B8
• Synonyms: D6S2245E; dJ1033B10.9; FABG; FABGL; H2-KE6; HKE6; KE6; RING2; SDR30C1
• ACCN: NM_014234
• Insert Size: 202
• Sequence Data:
  Insert Sequence

  >SC201842 3'UTR clone of NM_014234
  The sequence shown below is from the reference sequence of NM_014234. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAAGTCACTGGAGGTCTTTTCATGTAACTGCCTCAAGGACCCTGGACTCTGCTCACCCCCCCACCACTC
  TGCCTGGCCTCCTGCTGATGAGGACTCTAAGTTCCCAGGATACAAAAGGGGTGGCAGTGTATGGTTCAGG
  AATGCTGAATATGGGAAGCAGGGGTGCTTGTGACCCTAATAAATTCCAAGTCCTCTTCCCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014234.3
• Summary: In mice, the Ke6 protein is a 17-beta-hydroxysteroid dehydrogenase that can regulate the concentration of biologically active estrogens and androgens. It is preferentially an oxidative enzyme and inactivates estradiol, testosterone, and dihydrotestosterone. However, the enzyme has some reductive activity and can synthesize estradiol from estrone. The protein encoded by this gene is similar to Ke6 and is a member of the short-chain dehydrogenase superfamily. An alternatively spliced transcript of this gene has been detected, but the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
• Locus ID: 7923