GCAT (NM_014291) Human 3' UTR Clone

CAT#: SC201916

3`UTR clone of glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) (GCAT) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GCAT
• Synonyms: KBL
• ACCN: NM_014291
• Insert Size: 197
• Sequence Data:
  Insert Sequence

  >SC201916 3'UTR clone of NM_014291
  The sequence shown below is from the reference sequence of NM_014291. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAGGCCTTCGTGGAAGTGGGGCGACTGCACGGGGCACTGCCCTGAGCTCTGGGTAAGGACGAGAAGAGC
  CAAGGTCCGCCTACTGCCACAGGGTCAAAGGAGGTTTTCGATCAGCCCAGACCAGAGGCTCTGAGCCCTG
  AACCAAAGTCCCAGAGCTGGGCTGGGACGTGACCTGTGCTGAGGGCTGTGAGAATGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014291.3
• Summary: The degradation of L-threonine to glycine consists of a two-step biochemical pathway involving the enzymes L-threonine dehydrogenase and 2-amino-3-ketobutyrate coenzyme A ligase. L-Threonine is first converted into 2-amino-3-ketobutyrate by L-threonine dehydrogenase. This gene encodes the second enzyme in this pathway, which then catalyzes the reaction between 2-amino-3-ketobutyrate and coenzyme A to form glycine and acetyl-CoA. The encoded enzyme is considered a class II pyridoxal-phosphate-dependent aminotransferase. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 14. [provided by RefSeq, Jan 2010]
• Locus ID: 23464