PBR (TSPO) (NM_007311) Human 3' UTR Clone

CAT#: SC201919

3`UTR clone of translocator protein (18kDa) (TSPO) transcript variant PBR-S for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TSPO
• Synonyms: BPBS; BZRP; DBI; IBP; MBR; mDRC; PBR; PBS; pk18; PKBS; PTBR
• ACCN: NM_007311
• Insert Size: 204 bp
• Sequence Data:
  Insert Sequence

  >SC201919 3'UTR clone of NM_007311
  The sequence shown below is from the reference sequence of NM_007311. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCACGCTTGTGATGTGGTGGCCGTCACGCTTTCATGACCACTGGGCCTGCTAGTCTGTCAGGGCCTTGGC
  CCAGGGGTCAGCAGAGCTTCAGAGGTGGCCCCACCTGAGCCCCCACCCGGGAGCAGTGTCCTGTGCTTTC
  TGCATGCTTAGAGCATGTTCTTGGAACATGGAATTTTATAAGCTGAATAAAGTTTTTGACTTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_007311.3
• Summary: 'Present mainly in the mitochondrial compartment of peripheral tissues, the protein encoded by this gene interacts with some benzodiazepines and has different affinities than its endogenous counterpart. The protein is a key factor in the flow of cholesterol into mitochondria to permit the initiation of steroid hormone synthesis. Alternatively spliced transcript variants have been reported; one of the variants lacks an internal exon and is considered non-coding, and the other variants encode the same protein. [provided by RefSeq, Feb 2012]'
• Locus ID: 706