Iduronate 2 sulfatase (IDS) (NM_006123) Human 3' UTR Clone

CAT#: SC202029

3`UTR clone of iduronate 2-sulfatase (IDS) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IDS
• Synonyms: MPS2; SIDS
• ACCN: NM_006123
• Insert Size: 186 bp
• Sequence Data:
  Insert Sequence

  >SC202029 3'UTR clone of NM_006123
  The sequence shown below is from the reference sequence of NM_006123. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCGGATCATGGTTTCCTCATGAGGACAAATACCTGATTTTGAATAAAGCAGCATTCAGTTGAAATAACC
  CTTTCTGTGGTAATTCCAAGTGAATATTTTTCTTCTAGGTGATGAGTTTCTACTTCCTCTGGTTTTTACA
  ACAGGAAATGAAATGGTATCTAAAATAAACAAGCTGTGGTATGATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006123.4
• Summary: 'This gene encodes a member of the sulfatase family of proteins. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. This enzyme is involved in the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]'
• Locus ID: 3423