AKR1C4 (NM_001818) Human 3' UTR Clone

CAT#: SC202044

3`UTR clone of aldo-keto reductase family 1 member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase type I; dihydrodiol dehydrogenase 4) (AKR1C4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AKR1C4
• Synonyms: 3-alpha-HSD; C11; CDR; CHDR; DD-4; DD4; HAKRA
• ACCN: NM_001818
• Insert Size: 203 bp
• Sequence Data:
  Insert Sequence

  >SC202044 3'UTR clone of NM_001818
  The sequence shown below is from the reference sequence of NM_001818. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGGACCATCCTGATTATCCATTTTCAGATGAATATTAGCATAGAGGGTGTTGCACGACATCTAGCAGAA
  GGCCCTGTGTGTGGATGGTGATGCAGAGGATGTCTCTATGCTGGTGACTGGACACACAGCCTCTGGTTAA
  ATCCCTCCCCTCCTGCTTGGCAACTTCAGCTAGCTAGATATATCCATGGTCCAGAAAGCAAAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001818.2
• Summary: 'This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the bioreduction of chlordecone, a toxic organochlorine pesticide, to chlordecone alcohol in liver. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. [provided by RefSeq, Jul 2008]'
• Locus ID: 1109