TBL1Y (NM_134258) Human 3' UTR Clone

CAT#: SC202076

3`UTR clone of transducin (beta)-like 1Y-linked (TBL1Y) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TBL1Y
• Synonyms: DFNY2; TBL1
• ACCN: NM_134258
• Insert Size: 204
• Sequence Data:
  Insert Sequence

  >SC202076 3'UTR clone of NM_134258
  The sequence shown below is from the reference sequence of NM_134258. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGTCTGATGGCTCTGTGTGTGTTCTGGATCTGTGAAAGTAAACACAAAATATAGAAAAAAAGAAAAGAAT
  TCTAATGACCTGCCTTGAATGCATGGGGTTGCAGCTCTGTTCAAACACAATTCTATCAGCTCCAAAATGT
  GTGAACTTGACTTGTGTTAGAGTATATTCTGAAACCAACTTGTCCCAGGCCACAGGAGTGTATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_134258.1
• Summary: The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This gene is highly similar to TBL1X gene in nucleotide sequence and protein sequence, but the TBL1X gene is located on chromosome X and this gene is on chromosome Y. This gene has three alternatively spliced transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
• Locus ID: 90665