Eph receptor B6 (EPHB6) (NM_004445) Human 3' UTR Clone

CAT#: SC202078

3`UTR clone of EPH receptor B6 (EPHB6) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EPHB6
• Synonyms: HEP
• ACCN: NM_004445
• Insert Size: 223 bp
• Sequence Data:
  Insert Sequence

  >SC202078 3'UTR clone of NM_004445
  The sequence shown below is from the reference sequence of NM_004445. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCTCCTTCAGCAACACCTGAGGCAGCAGGGCTCAGTGGAGGTCTGAGAATGACGATACCCGTGACTCAG
  CCCTGGACACTGGTCCGAGAAGGGACATGTGGGACGTGAGCCGGGCTCCAACAGCCTCTGTGAGAGATGC
  CCCACACCAAACCCAACCCTCCCGATGGCTGCATTCCCTGGTCCTCCGCCTCTCCACCAGCCCCCTCCTC
  ATTAAAGGGAAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004445.3
• Summary: 'This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]'
• Locus ID: 2051