NME2 (NME1) (NM_001018136) Human 3' UTR Clone

CAT#: SC202138

3`UTR clone of NME1-NME2 readthrough transcript (NME1-NME2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NME1
• Synonyms: NM23-LV; NMELV
• ACCN: NM_001018136
• Insert Size: 157
• Sequence Data:
  Insert Sequence

  >SC202138 3'UTR clone of NM_001018136
  The sequence shown below is from the reference sequence of NM_001018136. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTCTTGTGCTCATGACTGGGTCTATGAATAAGAGGTGGACACAACAGCAGTCTCCTTCAGCACGGCGTGG
  TGTGTCCCTGGACACAGCTCTTCATTCCATTGACTTAGAGGCAACAGGATTGATCATTCTTTTATAGAGC
  ATATTTGCCAATAAAGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001018136.1
• Summary: This locus represents naturally occurring read-through transcription between the neighboring NME1 and NME2 genes. The significance of this read-through transcription and the function of the resulting protein product have not yet been determined. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2010]
• Locus ID: 654364