GNMT (NM_018960) Human 3' UTR Clone

CAT#: SC202165

3`UTR clone of glycine N-methyltransferase (GNMT) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GNMT
• Synonyms: glycine N-methyltransferase; OTTHUMP00000016412
• ACCN: NM_018960
• Insert Size: 185
• Sequence Data:
  Insert Sequence

  >SC202165 3'UTR clone of NM_018960
  The sequence shown below is from the reference sequence of NM_018960. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTGCTACTTCATCCACGTGCTCAAGAGGACAGACTGAGTGTGGCCTCAGCTCCCACAAGCCTCTGCCCA
  GGCACTGCTAGGCTCTGTCTGGAAGATGGGGACCAGCAGCCCCACACCAGGGCCAGCCTCTAGAGCAGAC
  TACAGCTGGGGTGCAGGGATGTGGGTTCCACAGACGGAAGGGTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_018960.4
• Summary: The protein encoded by this gene is an enzyme that catalyzes the conversion of S-adenosyl-L-methionine (along with glycine) to S-adenosyl-L-homocysteine and sarcosine. This protein is found in the cytoplasm and acts as a homotetramer. Defects in this gene are a cause of GNMT deficiency (hypermethioninemia). Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between the upstream CNPY3 (canopy FGF signaling regulator 3) gene and this gene and is represented with GeneID:107080644. [provided by RefSeq, Jan 2016]
• Locus ID: 27232