C5L2 (C5AR2) (NM_018485) Human 3' UTR Clone

CAT#: SC202269

3`UTR clone of G protein-coupled receptor 77 (GPR77) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: C5AR2
• Synonyms: C5L2; GPF77; GPR77
• ACCN: NM_018485
• Insert Size: 220
• Sequence Data:
  Insert Sequence

  >SC202269 3'UTR clone of NM_018485
  The sequence shown below is from the reference sequence of NM_018485. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGACCTGGTCTCGGAGATGGAGGTGTAGGCTGGAGAGACATTGTGGGTGTGTATCTTCTTATCTCATTT
  CACAAGACTGGCTTCAGGCATAGCTGGATCCAGGAGCTCAATGATGTCTTCATTTTATTCCTTCCTTCAT
  TCAACAGATATCCATCATGCACTTGCTATGTGCAAGGCCTTTTTAGGCACTAGAGATATAGCAGTGACCA
  AAACAGACAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_018485.1
• Summary: This gene encodes a G-protein coupled receptor 1 family member involved in the complement system of the innate immune response. Unlike classical G-protein coupled receptors, the encoded protein does not associate with intracellular G-proteins. It may instead modulate signal transduction through the beta-arrestin pathway, and may alternatively act as a decoy receptor. This gene may be involved in coronary artery disease and in the pathogenesis of sepsis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
• Locus ID: 27202