TEM8 (ANTXR1) (NM_053034) Human 3' UTR Clone

CAT#: SC202313

3`UTR clone of anthrax toxin receptor 1 (ANTXR1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ANTXR1
• Synonyms: ATR; GAPO; TEM8
• ACCN: NM_053034
• Insert Size: 181
• Sequence Data:
  Insert Sequence

  >SC202313 3'UTR clone of NM_053034
  The sequence shown below is from the reference sequence of NM_053034. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCCGAGGAGAGTGAGGAAAATAAAATAAAATAACAAGAAGAAGAAAGAAAGAAATCCCACAGAAACAGA
  TAACCTAACACAGCCCGTGCAACGTATTTTATACAATGCTCTGAAAATCATAGTCTCAATCTAGACAGTC
  TTTTCCTCTAGTTCCCTGTATTCAAATCCCAGTGTCTAACA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_053034.2
• Summary: This gene encodes a type I transmembrane protein and is a tumor-specific endothelial marker that has been implicated in colorectal cancer. The encoded protein has been shown to also be a docking protein or receptor for Bacillus anthracis toxin, the causative agent of the disease, anthrax. The binding of the protective antigen (PA) component, of the tripartite anthrax toxin, to this receptor protein mediates delivery of toxin components to the cytosol of cells. Once inside the cell, the other two components of anthrax toxin, edema factor (EF) and lethal factor (LF) disrupt normal cellular processes. Three alternatively spliced variants that encode different protein isoforms have been described. [provided by RefSeq, Oct 2008]
• Locus ID: 84168