PARP4 (NM_006437) Human 3' UTR Clone

CAT#: SC202316

3`UTR clone of poly (ADP-ribose) polymerase family member 4 (PARP4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PARP4
• Synonyms: ADPRTL1; ARTD4; p193; PARP-4; PARPL; PH5P; VAULT3; VPARP; VWA5C
• ACCN: NM_006437
• Insert Size: 191 bp
• Sequence Data:
  Insert Sequence

  >SC202316 3'UTR clone of NM_006437
  The sequence shown below is from the reference sequence of NM_006437. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTCCATTACAGTCAAGGCTAAGTCAAATGAAACTGAATTTTAAACTTTTTGCATGCTTCTATGTAGAAA
  ATAATCAAATGATAATAGATACTTATAATGAAACTTCATTAAGGTTTCATTCAGTGTAGCAATTACTGTC
  TTTAAAAATTAAGTGGAAGAAGAATTACTTTAATCAACTAACAAGCAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006437.3
• Summary: 'This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]'
• Locus ID: 143