NAD Synthetase (NADSYN1) (NM_018161) Human 3' UTR Clone

CAT#: SC202336

3`UTR clone of NAD synthetase 1 (NADSYN1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NADSYN1
• Synonyms: FLJ10631; FLJ36703; FLJ40627
• ACCN: NM_018161
• Insert Size: 199
• Sequence Data:
  Insert Sequence

  >SC202336 3'UTR clone of NM_018161
  The sequence shown below is from the reference sequence of NM_018161. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAGCCACAGTCCCTGGACGGCGTGGACTGAGGCCGGTTCCTTCCTGGAGGCCTCCTGTCCTCGGGGACC
  CCAGCACCTCATCATCAGCATTGCTGGAGCCAAGGGTAGGAGCCCTACACTAGGAGCCCAGGATGGGACG
  GCGCATCAGCCGAGAGGGAGGGAACTTTTCAGTCAAATTCCTCAAAAAGAGGCTGGAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_018161.4
• Summary: Nicotinamide adenine dinucleotide (NAD) is a coenzyme in metabolic redox reactions, a precursor for several cell signaling molecules, and a substrate for protein posttranslational modifications. NAD synthetase (EC 6.3.5.1) catalyzes the final step in the biosynthesis of NAD from nicotinic acid adenine dinucleotide (NaAD). [supplied by OMIM, Apr 2004]
• Locus ID: 55191