FXYD1 (NM_021902) Human 3' UTR Clone

CAT#: SC202356

3`UTR clone of FXYD domain containing ion transport regulator 1 (FXYD1) transcript variant b for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "FXYD1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol FXYD1
Synonyms PLM
ACCN NM_021902
Insert Size 190 bp
Sequence Data
>SC202356 3'UTR clone of NM_021902
The sequence shown below is from the reference sequence of NM_021902. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAACTTTCCGCAGCTCCATCCGCCGTCTGTCCACCCGCAGGCGGTAGAAACACCTGGAGCGATGGAATCC
GGCCAGGACTCCCCTGGCACCTGACATCTCCCACGCTCCACCTGCGCGCCCACCGCCCCCTCCGCCGCCC
CTTCCCCAGCCCTGCCCCCGCAGACTCCCCCTGCCGCCAAGACTTCCAAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_021902.2
Summary 'This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. The protein encoded by this gene is a plasma membrane substrate for several kinases, including protein kinase A, protein kinase C, NIMA kinase, and myotonic dystrophy kinase. It is thought to form an ion channel or regulate ion channel activity. Transcript variants with different 5' UTR sequences have been described in the literature. [provided by RefSeq, Jul 2008]'
Locus ID 5348

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.