Complement factor 8 beta (C8B) (NM_000066) Human 3' UTR Clone

CAT#: SC202395

3`UTR clone of complement component 8 beta polypeptide (C8B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: C8B
• Synonyms: C82
• ACCN: NM_000066
• Insert Size: 190 bp
• Sequence Data:
  Insert Sequence

  >SC202395 3'UTR clone of NM_000066
  The sequence shown below is from the reference sequence of NM_000066. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGAAACACTTGACTGCTCCTAGCAGATGATACAGCAGTGGGCTACATACAATGAGAGCCCTGAGCCCTC
  AAGAACTCATGCCAGCTCAGCCCTACACCAGTTTCCACCTGGAGTTCATGCAAGGGCAAAAGGCAGTGCC
  ATGCAAGCTGTTTAAAATAAAGATGTTACCTTGTAAAATGCAAGTTGATT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000066.2
• Summary: 'This gene encodes one of the three subunits of the complement component 8 (C8) protein. C8 is composed of equimolar amounts of alpha, beta and gamma subunits, which are encoded by three separate genes. C8 is one component of the membrane attack complex, which mediates cell lysis, and it initiates membrane penetration of the complex. This protein mediates the interaction of C8 with the C5b-7 membrane attack complex precursor. In humans deficiency of this protein is associated with increased risk of meningococcal infections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]'
• Locus ID: 732