Factor I (CFI) (NM_000204) Human 3' UTR Clone

CAT#: SC202412

3`UTR clone of complement factor I (CFI) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CFI
• Synonyms: AHUS3; ARMD13; C3b-INA; C3BINA; FI; IF; KAF
• ACCN: NM_000204
• Insert Size: 228 bp
• Sequence Data:
  Insert Sequence

  >SC202412 3'UTR clone of NM_000204
  The sequence shown below is from the reference sequence of NM_000204. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCTACCATGTAGGAAGGCCTTTTATTTCTCAGTACAATGTATAAAATTGTGATCTCTCTCTTCATTCTA
  TTCTTTTTCTCTCAAGAGTTCCATTTAATGGAAATAAAACGGTATAATTAATAATTCTCTAGGGGGGAAA
  AATGAAGCAAATCTCACTGGATATTTTTAAAGGTCTCCACAGAGTTTATGCCATATTGGAATTTTGTTGT
  ATAATTCTCAAATAAATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000204.3
• Summary: 'This gene encodes a serine proteinase that is essential for regulating the complement cascade. The encoded preproprotein is cleaved to produce both heavy and light chains, which are linked by disulfide bonds to form a heterodimeric glycoprotein. This heterodimer can cleave and inactivate the complement components C4b and C3b, and it prevents the assembly of the C3 and C5 convertase enzymes. Defects in this gene cause complement factor I deficiency, an autosomal recessive disease associated with a susceptibility to pyogenic infections. Mutations in this gene have been associated with a predisposition to atypical hemolytic uremic syndrome, a disease characterized by acute renal failure, microangiopathic hemolytic anemia and thrombocytopenia. Primary glomerulonephritis with immune deposits and age-related macular degeneration are other conditions associated with mutations of this gene. [provided by RefSeq, Dec 2015]'
• Locus ID: 3426