WDR61 (NM_025234) Human 3' UTR Clone

CAT#: SC202418

3`UTR clone of WD repeat domain 61 (WDR61) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: WDR61
• Synonyms: REC14; SKI8
• ACCN: NM_025234
• Insert Size: 220
• Sequence Data:
  Insert Sequence

  >SC202418 3'UTR clone of NM_025234
  The sequence shown below is from the reference sequence of NM_025234. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGTTGGAGATGACCAGGAAATTCACATCTATGATTGTCCAATTTAAACATCAAAGTCTCCAGGCTTATG
  CTGCAAAGAGAATGTACGGATTGATCATGACATTCCTTACCTTCTTAGGCTTGTTTAAAAGAAATATAGC
  ATTTATTGTAGCAAAGACTTAAATTTTGTAGATACAATATGAATCTTTTCATGTTTTATTGGAAATGCTG
  TTCATACTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_025234.1
• Summary: WDR61 is a subunit of the human PAF and SKI complexes, which function in transcriptional regulation and are involved in events downstream of RNA synthesis, such as RNA surveillance (Zhu et al., 2005 [PubMed 16024656]). [supplied by OMIM, Mar 2008]
• Locus ID: 80349