RAMP2 (NM_005854) Human 3' UTR Clone

CAT#: SC202422

3`UTR clone of receptor (G protein-coupled) activity modifying protein 2 (RAMP2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RAMP2
• ACCN: NM_005854
• Insert Size: 189
• Sequence Data:
  Insert Sequence

  >SC202422 3'UTR clone of NM_005854
  The sequence shown below is from the reference sequence of NM_005854. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAGGAGTAAAGACAGTGAGGCCCAGGCCTAGGGGGCCACGAGCTTCTCAACAACCATGTTACTCCACTT
  CCCCACCCCCACCAGGCCTCCCTCCTCCCCTCCTACTCCCTTTTCTCACTCTCATCCCCACCACAGATCC
  CTGGATTGCTGGGAATGGAAGCCAGGTGGGGTCATGGCACAAGTTCTGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005854.2
• Summary: The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP2) protein, CRLR functions as an adrenomedullin receptor. The RAMP2 protein is involved in core glycosylation and transportation of adrenomedullin receptor to the cell surface. [provided by RefSeq, Jul 2008]
• Locus ID: 10266