UAP56 (DDX39B) (NM_080598) Human 3' UTR Clone

CAT#: SC202496

3`UTR clone of HLA-B associated transcript 1 (BAT1) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DDX39B"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DDX39B
Synonyms BAT1; D6S81E; UAP56
ACCN NM_080598
Insert Size 235
Sequence Data
>SC202496 3'UTR clone of NM_080598
The sequence shown below is from the reference sequence of NM_080598. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCTACATTGAACAGACACGGTAGAAGACTCGCCCATTTTGGAATGTGACCGTCTGTCCTTCAGGAGAGGA
CACCAGGGTGGGGGTGAAGGAGACACTACTGCCCCCACCCCTGACAGCCCCCACCCCATGGCTTCCATCT
TTTGCATCACCACCACTCCTGAACCCCCATTTCTGATTTGTCAGAATTTTTTTTTAACAAAACTAAAAAT
GAAACACATGTGTCTGTGGTATCTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_080598.4
Summary This gene encodes a member of the DEAD box family of RNA-dependent ATPases that mediate ATP hydrolysis during pre-mRNA splicing. The encoded protein is an essential splicing factor required for association of U2 small nuclear ribonucleoprotein with pre-mRNA, and it also plays an important role in mRNA export from the nucleus to the cytoplasm. This gene belongs to a cluster of genes localized in the vicinity of the genes encoding tumor necrosis factor alpha and tumor necrosis factor beta. These genes are all within the human major histocompatibility complex class III region. Mutations in this gene may be associated with rheumatoid arthritis. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on both chromosomes 6 and 11. Read-through transcription also occurs between this gene and the upstream ATP6V1G2 (ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2) gene. [provided by RefSeq, Feb 2011]
Locus ID 7919

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.