UAP56 (DDX39B) (NM_004640) Human 3' UTR Clone

CAT#: SC202497

3`UTR clone of HLA-B associated transcript 1 (BAT1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DDX39B
• Synonyms: BAT1; D6S81E; UAP56
• ACCN: NM_004640
• Insert Size: 235
• Sequence Data:
  Insert Sequence

  >SC202497 3'UTR clone of NM_004640
  The sequence shown below is from the reference sequence of NM_004640. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTACATTGAACAGACACGGTAGAAGACTCGCCCATTTTGGAATGTGACCGTCTGTCCTTCAGGAGAGGA
  CACCAGGGTGGGGGTGAAGGAGACACTACTGCCCCCACCCCTGACAGCCCCCACCCCATGGCTTCCATCT
  TTTGCATCACCACCACTCCTGAACCCCCATTTCTGATTTGTCAGAATTTTTTTTTAACAAAACTAAAAAT
  GAAACACATGTGTCTGTGGTATCTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004640.5
• Summary: This gene encodes a member of the DEAD box family of RNA-dependent ATPases that mediate ATP hydrolysis during pre-mRNA splicing. The encoded protein is an essential splicing factor required for association of U2 small nuclear ribonucleoprotein with pre-mRNA, and it also plays an important role in mRNA export from the nucleus to the cytoplasm. This gene belongs to a cluster of genes localized in the vicinity of the genes encoding tumor necrosis factor alpha and tumor necrosis factor beta. These genes are all within the human major histocompatibility complex class III region. Mutations in this gene may be associated with rheumatoid arthritis. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on both chromosomes 6 and 11. Read-through transcription also occurs between this gene and the upstream ATP6V1G2 (ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2) gene. [provided by RefSeq, Feb 2011]
• Locus ID: 7919