MAP3K6 (NM_004672) Human 3' UTR Clone

CAT#: SC202519

3`UTR clone of mitogen-activated protein kinase kinase kinase 6 (MAP3K6) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAP3K6
• Synonyms: ASK2; MAPKKK6; MEKK6
• ACCN: NM_004672
• Insert Size: 214
• Sequence Data:
  Insert Sequence

  >SC202519 3'UTR clone of NM_004672
  The sequence shown below is from the reference sequence of NM_004672. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATCCACACCAGTCACCTCTGGACCCTGAGAGCTGAATGAGGGCATCATAGGCCAGACAGGCCCAAGGATG
  GATGAATGGAGAGGACAAAGGCAGCTTCTGACACACCAGCCCCAGGACCTGGGGCGACTGGAGGAAGCCA
  GGCGAGTGGGGCCCAGGACTGGTTCCAGTGAGAGAAACCAACCACAGGCACCCAAGCACTACCAGACAAA
  GCGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004672.3
• Summary: This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
• Locus ID: 9064