RTBDN (NM_001080997) Human 3' UTR Clone

CAT#: SC202608

3`UTR clone of retbindin (RTBDN) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RTBDN
• Synonyms: FLJ36353
• ACCN: NM_001080997
• Insert Size: 255
• Sequence Data:
  Insert Sequence

  >SC202608 3'UTR clone of NM_001080997
  The sequence shown below is from the reference sequence of NM_001080997. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAGTGGCAGTGGAAGCGGCAGCGGCCCCTAGCGGACGCGTGGCCCTGAGTTGGGGGAGCGACCCTTCCC
  CCAGCCCCGCCCCTCAGGACACCCAGAACCCCACCCCTCGTCCTCTCGGCCTTCTGTAATAGTTTTGAGA
  TGTCTGTCCCTCCTCCCTGGAGCTCCAGAGACCCACCCCTCTCCAGGTTATCCCAGAAATGACCCAACTC
  TCTCACTTTTCCCTCTCCCCTTTGAATAAAGTCGCCAGCTAGAGC
  
  CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-RsrII
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001080997.1
• Summary: This gene was first identified in a study of human eye tissues. The protein encoded by this gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
• Locus ID: 83546