IFI30 (NM_006332) Human 3' UTR Clone

CAT#: SC202662

3`UTR clone of interferon gamma-inducible protein 30 (IFI30) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IFI30
• Synonyms: GILT; IFI-30; IP-30; IP30
• ACCN: NM_006332
• Insert Size: 207
• Sequence Data:
  Insert Sequence

  >SC202662 3'UTR clone of NM_006332
  The sequence shown below is from the reference sequence of NM_006332. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTCAGGAGTGTTTGCTTCAAGTGATGGCCGGTGAGCTGCGGAGAGCTCATGGAAGGCGAGTGGGAACCC
  GGCTGCCTGCCTTTTTTTCTGATCCAGACCCTCGGCACCTGCTACTTACCAACTGGAAAATTTTATGCAT
  CCCATGAAGCCCAGATACACAAAATTCCACCCCATGATCAAGAATCCTGCTCCACTAAGAATGGTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006332.3
• Summary: The protein encoded by this gene is a lysosomal thiol reductase that at low pH can reduce protein disulfide bonds. The enzyme is expressed constitutively in antigen-presenting cells and induced by gamma-interferon in other cell types. This enzyme has an important role in MHC class II-restricted antigen processing. [provided by RefSeq, Jul 2008]
• Locus ID: 10437