RAD54B (NM_012415) Human 3' UTR Clone

CAT#: SC202665

3`UTR clone of RAD54 homolog B (S. cerevisiae) (RAD54B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RAD54B
• Synonyms: RDH54
• ACCN: NM_012415
• Insert Size: 232
• Sequence Data:
  Insert Sequence

  >SC202665 3'UTR clone of NM_012415
  The sequence shown below is from the reference sequence of NM_012415. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCACTCAAGCTACTGGCACATAGTGAAAGATTACTTCTGACATTCCATTGCTCTTCTTTTGAAAATTAG
  TATGGTAATTAAATGTACTTTTTGAAAATTAATAGAATTATTTAAATTACAGTATATGTTGCAAAATATA
  TCACTTTTGATACAATAGTCAAAATTGAGTGGTTTAATGTTTTGTAAATATTAAGTGTTTAAATGAAAAA
  TAAAGATGTGCTTATATCATTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_012415.2
• Summary: The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination. Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. [provided by RefSeq, Jul 2008]
• Locus ID: 25788