NDUFA2 (NM_002488) Human 3' UTR Clone

CAT#: SC202685

3`UTR clone of NADH dehydrogenase (ubiquinone) 1 alpha subcomplex2 8kDa (NDUFA2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NDUFA2
• Synonyms: B8; CD14; CIB8; MC1DN13
• ACCN: NM_002488
• Insert Size: 230 bp
• Sequence Data:
  Insert Sequence

  >SC202685 3'UTR clone of NM_002488
  The sequence shown below is from the reference sequence of NM_002488. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATCAGGTAACCAGAGCCCTGGAGAACGTTCTAAGTGGTAAAGCCTGAAGCCTCCACTGAGGATTAAGAGC
  AACAGCCCCAGAGCCTGGGCTCTGCTGGACTTAGTATAATGTGAAAAAAATGTGTTCTCCTATTCCTCAT
  AAAGCTTGTGCTGTAAAATACTTTCTCAGGGTGTTCTTGTCCTCATCTACCCTCTACCCCTTACTGTGCA
  ACCACTGAGGCAAAGTAGCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002488.3
• Summary: 'The encoded protein is a subunit of the hydrophobic protein fraction of the NADH:ubiquinone oxidoreductase (complex 1), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane, and may be involved in regulating complex I activity or its assembly via assistance in redox processes. Mutations in this gene are associated with Leigh syndrome, an early-onset progressive neurodegenerative disorder. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]'
• Locus ID: 4695