NEIL1 (NM_024608) Human 3' UTR Clone

CAT#: SC202702

3`UTR clone of nei endonuclease VIII-like 1 (E. coli) (NEIL1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NEIL1
• Synonyms: FPG1; hFPG1; NEI1
• ACCN: NM_024608
• Insert Size: 223
• Sequence Data:
  Insert Sequence

  >SC202702 3'UTR clone of NM_024608
  The sequence shown below is from the reference sequence of NM_024608. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCATCCTTGGAACCAGAGGGGACCTCAGCCTCTTAGCAGGAGGCTCTCCTTGCTTGCACTCACCCTTTCT
  TATTGTCTTGCCCTGCATCTGGGGGTCTGAATTTTTGGGAGCAGGCAATATCTGAAGGTGCAAACAGGCC
  CTACGGCTGTTCCCTGCACAACTCTCATGGTTTTAATTGTACCCCATCTTCCACATCTTTAAAGCTCATG
  TGAAAAATGCTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_024608.2
• Summary: This gene is a member of the Nei endonuclease VIII-like gene family which encodes DNA glycosylases. The encoded enzyme participates in the DNA repair pathway by initiating base excision repair by removing damaged bases, primarily oxidized pyrimidines. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
• Locus ID: 79661