Apc5 (ANAPC5) (NM_001137559) Human 3' UTR Clone

CAT#: SC202825

3`UTR clone of anaphase promoting complex subunit 5 (ANAPC5) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ANAPC5
• Synonyms: APC5
• ACCN: NM_001137559
• Insert Size: 251
• Sequence Data:
  Insert Sequence

  >SC202825 3'UTR clone of NM_001137559
  The sequence shown below is from the reference sequence of NM_001137559. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATCAGGAGCTGCCCTCTCATGGGGTACCCTTGATAAACCATCTCTAGAGAGGACATCCCTGCTGGGCTGC
  TGTGCAGAGTATAAGATTTTGGACTTGTTCATGTCCCCTCTCTCCCTATAAATGATGTATTTGTGACACC
  CTATCTTGTCAATAAACAGCATTCTGATTAGTTTGTCTTATTTTGTTGCTAGTAACTACGTATTTGTTTT
  ATTCCCCTTTTCTTCCCTTTTGGTAGCAAAGGACACCAACT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001137559.1
• Summary: This gene encodes a tetratricopeptide repeat-containing component of the anaphase promoting complex/cyclosome (APC/C), a large E3 ubiquitin ligase that controls cell cycle progression by targeting a number of cell cycle regulators such as B-type cyclins for 26S proteasome-mediated degradation through ubiquitination. The encoded protein is required for the proper ubiquitination function of APC/C and for the interaction of APC/C with transcription coactivators. It also interacts with polyA binding protein and represses internal ribosome entry site-mediated translation. Multiple transcript variants encoding different isoforms have been found for this gene. These differences cause translation initiation at a downstream AUG and result in a shorter protein (isoform b), compared to isoform a. [provided by RefSeq, Nov 2008]
• Locus ID: 51433