COX8A (NM_004074) Human 3' UTR Clone

CAT#: SC202857

3`UTR clone of cytochrome c oxidase subunit 8A (ubiquitous) (COX8A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: COX8A
• Synonyms: COX; COX8; COX8-2; COX8L; VIII; VIII-L
• ACCN: NM_004074
• Insert Size: 230
• Sequence Data:
  Insert Sequence

  >SC202857 3'UTR clone of NM_004074
  The sequence shown below is from the reference sequence of NM_004074. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATCCTGTCACACCTGGAGACCTACAGGAGGCCAGAGTGAAGGGGTCCGTTCTGTCCCTCACACTGTGACC
  TGACCAGCCCCACCGGCCCATCCTGGTCATGTTACTGCATTTGTGGCCGGCCTCCCCTGGATCATGTCAT
  TCAATTCCAGTCACCTCTTCTGCAATCATGACCTCTTGATGTCTCCATGGTGACCTCCTTGGGGGTCACT
  GACCCTGCTTGGTGGGGTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004074.2
• Summary: The protein encoded by this gene is the terminal enzyme of the respiratory chain, coupling the transfer of electrons from cytochrome c to molecular oxygen, with the concomitant production of a proton electrochemical gradient across the inner mitochondrial membrane. In addition to 3 mitochondrially encoded subunits, which perform the catalytic function, the eukaryotic enzyme contains nuclear-encoded smaller subunits, ranging in number from 4 in some organisms to 10 in mammals. It has been proposed that nuclear-encoded subunits may be involved in the modulation of the catalytic function. This gene encodes one of the nuclear-encoded subunits. [provided by RefSeq, Jul 2008]
• Locus ID: 1351