Acetylcholinesterase (ACHE) (NM_000665) Human 3' UTR Clone

CAT#: SC202928

3`UTR clone of acetylcholinesterase (Yt blood group) (ACHE) transcript variant E4-E6 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ACHE"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ACHE
Synonyms ACEE; ARACHE; N-ACHE; YT
ACCN NM_000665
Insert Size 247 bp
Sequence Data
>SC202928 3'UTR clone of NM_000665
The sequence shown below is from the reference sequence of NM_000665. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACCACTACAGCAAGCAGGATCGCTGCTCAGACCTGTGACCCCGGCGGGACCCCCATGTCCTCCGCTCCGC
CCGGCCCCCTAGCTGTATATACTATTTATTTCAGGGCTGGGCTATAACACAGACGAGCCCCAGACTCTGC
CCATCCCCACCCCACCCCGACGTCCCCCGGGGCTCCCGGTCCTCTGCATGTCTCAGGCTGAGCTCCCTCC
CCCGCGGTGCCTTCGCCCCTCTGGGCTGCCAATAAAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000665.3
Summary 'Acetylcholinesterase hydrolyzes the neurotransmitter, acetylcholine at neuromuscular junctions and brain cholinergic synapses, and thus terminates signal transmission. It is also found on the red blood cell membranes, where it constitutes the Yt blood group antigen. Acetylcholinesterase exists in multiple molecular forms which possess similar catalytic properties, but differ in their oligomeric assembly and mode of cell attachment to the cell surface. It is encoded by the single ACHE gene, and the structural diversity in the gene products arises from alternative mRNA splicing, and post-translational associations of catalytic and structural subunits. The major form of acetylcholinesterase found in brain, muscle and other tissues is the hydrophilic species, which forms disulfide-linked oligomers with collagenous, or lipid-containing structural subunits. The other, alternatively spliced form, expressed primarily in the erythroid tissues, differs at the C-terminal end, and contains a cleavable hydrophobic peptide with a GPI-anchor site. It associates with the membranes through the phosphoinositide (PI) moieties added post-translationally. AChE activity may constitute a sensitive biomarker of RBC ageing in vivo, and thus, may be of aid in understanding the effects of transfusion[provided by RefSeq, Sep 2019]'
Locus ID 43

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.