TBXAS1 (NM_001061) Human 3' UTR Clone

CAT#: SC202950

3`UTR clone of thromboxane A synthase 1 (platelet) (TBXAS1) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TBXAS1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TBXAS1
Synonyms BDPLT14; CYP5; CYP5A1; GHOSAL; THAS; TS; TXAS; TXS
ACCN NM_001061
Insert Size 237 bp
Sequence Data
>SC202950 3'UTR clone of NM_001061
The sequence shown below is from the reference sequence of NM_001061. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCAAGATCGTATCCCGCTGACACAGAAGGCTGCCGGGTGGGGGGAGGGCACCCCCAAATTCAAAGAAAAC
CCTAAGTGTGGATGTTCAGAATTTTGGAAAAATGTCACTGAAGTGATTGAAAGAGTGCCTGGCATGCAAG
GATAAGAGGTTCTTTACATAACATTTCCTAAATGCTTAATAAACGTTTGTTGCACTTGGTTTTGACATTG
CCAATGGGGTTTGAACCAGTGCTCTCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001061.4
Summary 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to thromboxane A2, a potent vasoconstrictor and inducer of platelet aggregation. The enzyme plays a role in several pathophysiological processes including hemostasis, cardiovascular disease, and stroke. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]'
Locus ID 6916

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.