GCDH (NM_013976) Human 3' UTR Clone

CAT#: SC202966

3`UTR clone of glutaryl-Coenzyme A dehydrogenase (GCDH) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GCDH
• Synonyms: ACAD5; GCD
• ACCN: NM_013976
• Insert Size: 244
• Sequence Data:
  Insert Sequence

  >SC202966 3'UTR clone of NM_013976
  The sequence shown below is from the reference sequence of NM_013976. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAGTCGTTCAGATGTGTTCCTTAAAAAGAAGATGGAATTCTCTGTAGAGCGTCTCAATCCACTTTTAACC
  ATGGATGAGAGCAGACTCCATTTACCCTGAAATAGCAGCTTCTCTTGAGAGGAGAGTGACATGGAAGCAA
  CTCCGTCTGCTGCAGCTGACCCCCTCACACTGAGTTCACAGTGCGCCCTCCCTCCCTCCCATCTGGGGGT
  AGTGCCTTATGCTGGGTGTTGGAGCAGAGTGAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_013976.2
• Summary: The protein encoded by this gene belongs to the acyl-CoA dehydrogenase family. It catalyzes the oxidative decarboxylation of glutaryl-CoA to crotonyl-CoA and CO(2) in the degradative pathway of L-lysine, L-hydroxylysine, and L-tryptophan metabolism. It uses electron transfer flavoprotein as its electron acceptor. The enzyme exists in the mitochondrial matrix as a homotetramer of 45-kD subunits. Mutations in this gene result in the metabolic disorder glutaric aciduria type 1, which is also known as glutaric acidemia type I. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 12. [provided by RefSeq, Mar 2013]
• Locus ID: 2639