p107 (RBL1) (NM_183404) Human 3' UTR Clone

CAT#: SC203041

3`UTR clone of retinoblastoma-like 1 (p107) (RBL1) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

5 Days*

Size
    • 10 ug

Product Images

Other products for "RBL1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol RBL1
Synonyms CP107; p107; PRB1
ACCN NM_183404
Insert Size 125 bp
Sequence Data
>SC203041 3'UTR clone of NM_183404
The sequence shown below is from the reference sequence of NM_183404. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTTCAATGGCAGCCCTTCTAAGGTAAGGTGAATAGGCTAAAAGTTGGATTTCAGATTAACAGTCAGTAAC
TGTTAATCCTGCCTCTTTTTTTTTTTTTCTTTTTTGGCCAAGTTACTACTATACT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_183404.1
Summary 'The protein encoded by this gene is similar in sequence and possibly function to the product of the retinoblastoma 1 (RB1) gene. The RB1 gene product is a tumor suppressor protein that appears to be involved in cell cycle regulation, as it is phosphorylated in the S to M phase transition and is dephosphorylated in the G1 phase of the cell cycle. Both the RB1 protein and the product of this gene can form a complex with adenovirus E1A protein and SV40 large T-antigen, with the SV40 large T-antigen binding only to the unphosphorylated form of each protein. In addition, both proteins can inhibit the transcription of cell cycle genes containing E2F binding sites in their promoters. Due to the sequence and biochemical similarities with the RB1 protein, it is thought that the protein encoded by this gene may also be a tumor suppressor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
Locus ID 5933

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.