Macrophage Inflammatory Protein 3 beta (CCL19) (NM_006274) Human 3' UTR Clone

CAT#: SC203050

3`UTR clone of chemokine (C-C motif) ligand 19 (CCL19) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CCL19
• Synonyms: CKb11; ELC; MIP-3b; MIP3B; SCYA19
• ACCN: NM_006274
• Insert Size: 281 bp
• Sequence Data:
  Insert Sequence

  >SC203050 3'UTR clone of NM_006274
  The sequence shown below is from the reference sequence of NM_006274. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGGACCTCAGCCAAGATGAAGCGCCGCAGCAGTTAACCTATGACCGTGCAGAGGGAGCCCGGAGTCCGA
  GTCAAGCATTGTGAATTATTACCTAACCTGGGGAACCGAGGACCAGAAGGAAGGACCAGGCTTCCAGCTC
  CTCTGCACCAGACCTGACCAGCCAGGACAGGGCCTGGGGTGTGTGTGAGTGTGAGTGTGAGCGAGAGGGT
  GAGTGTGGTCAGAGTAAAGCTGCTCCACCCCCAGATTGCAATGCTACCAATAAAGCCGCCTGGTGTTTAC
  A
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006274.2
• Summary: 'This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene may play a role in normal lymphocyte recirculation and homing. It also plays an important role in trafficking of T cells in thymus, and in T cell and B cell migration to secondary lymphoid organs. It specifically binds to chemokine receptor CCR7. [provided by RefSeq, Sep 2014]'
• Locus ID: 6363