CLCA1 (NM_001285) Human 3' UTR Clone

CAT#: SC203051

3`UTR clone of chloride channel accessory 1 (CLCA1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CLCA1
• Synonyms: CACC; CaCC-1; CACC1; CLCRG1; GOB5; hCaCC-1; hCLCA1
• ACCN: NM_001285
• Insert Size: 259 bp
• Sequence Data:
  Insert Sequence

  >SC203051 3'UTR clone of NM_001285
  The sequence shown below is from the reference sequence of NM_001285. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAAGTGGATAGGAGAACTGCAGCTGTCAATAGCCTAGGGCTGAATTTTTGTCAGATAAATAAAATAAAT
  CATTCATCCTTTTTTTTGATTATAAAATTTTCTAAAATGTATTTTAGACTTCCTGTAGGGGGCGATATAC
  TAAATGTATATAGTACATTTATACTAAATGTATTCCTGTAGGGGGCGATATACTAAATGTATTTTAGACT
  TCCTGTAGGGGGCGATAAAATAAAATGCTAAACAACTGGGTATACATGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001285.3
• Summary: 'This gene encodes a member of the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same region on chromosome 1p31-p22 and share a high degree of homology in size, sequence, and predicted structure, but differ significantly in their tissue distributions. The encoded protein is expressed as a precursor protein that is processed into two cell-surface-associated subunits, although the site at which the precursor is cleaved has not been precisely determined. The encoded protein may be involved in mediating calcium-activated chloride conductance in the intestine. [provided by RefSeq, Jul 2008]'
• Locus ID: 1179