MTHFS (NM_006441) Human 3' UTR Clone

CAT#: SC203056

3`UTR clone of 510-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) (MTHFS) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MTHFS
• Synonyms: HsT19268; NEDMEHM
• ACCN: NM_006441
• Insert Size: 242
• Sequence Data:
  Insert Sequence

  >SC203056 3'UTR clone of NM_006441
  The sequence shown below is from the reference sequence of NM_006441. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACGAAGACTCGTCAACAGCTTAAATCTGGATTACTACAGCCAAATAATCAGTGTTTTATATGAGAGTAAA
  GCAAAGTATGTGTATTTTTCCCTTGTCAAAAATTAGTTGAAATTGTTCATTAATGTGAATACAGACTGCA
  TTTTAAAATTGTAATTATGAAATACCTTATATAAAACCATCTTTAAAAACCAATAGAAGTGTGAATAGTA
  GAATATTAATTAAAATGGAGGCTATCAGCCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006441.2
• Summary: The protein encoded by this gene is an enzyme that catalyzes the conversion of 5-formyltetrahydrofolate to 5,10-methenyltetrahydrofolate, a precursor of reduced folates involved in 1-carbon metabolism. An increased activity of the encoded protein can result in an increased folate turnover rate and folate depletion. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
• Locus ID: 10588