C2orf28 (ATRAID) (NM_016085) Human 3' UTR Clone

CAT#: SC203078

3`UTR clone of chromosome 2 open reading frame 28 (C2orf28) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ATRAID"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ATRAID
Synonyms APR--3; APR-3; APR3; C2orf28; HSPC013; p18; PRO240
ACCN NM_016085
Insert Size 230
Sequence Data
>SC203078 3'UTR clone of NM_016085
The sequence shown below is from the reference sequence of NM_016085. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGCCGAAAAGCCAAGACTTCATGAACTACATAGGTCTTACCATTGACCTAAGATCAATCTGAACTATCTT
AGCCCAGTCAGGGAGCTCTGCTTCCTAGAAAGGCATCTTTCGCCAGTGGATTCGCCTCAAGGTTGAGGCC
GCCATTGGAAGATGAAAAATTGCACTCCCTTGGTGTAGACAAATACCAGTTCCCATTGGTGTTGTTGCCT
ATAATAAACACTTTTTTCTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016085.4
Summary This gene is thought to be involved in apoptosis, and may also be involved in hematopoietic development and differentiation. The use of alternative splice sites and promotors result in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2009]
Locus ID 51374

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.