P70 S6 Kinase beta (RPS6KB2) (NM_003952) Human 3' UTR Clone

CAT#: SC203095

3`UTR clone of ribosomal protein S6 kinase 70kDa polypeptide 2 (RPS6KB2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RPS6KB2
• Synonyms: KLS; p70(S6K)-beta; P70-beta; P70-beta-1; P70-beta-2; p70S6Kb; S6K-beta2; S6K2; S6KB; S6Kbeta; S6KI(2); SRK; STK14B
• ACCN: NM_003952
• Insert Size: 258 bp
• Sequence Data:
  Insert Sequence

  >SC203095 3'UTR clone of NM_003952
  The sequence shown below is from the reference sequence of NM_003952. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GACCAAGAAGTCCAAGAGGGGCCGTGGGCGTCCAGGGCGCTAGGAAGCCGGGTGGGGGTGAGGGTAGCCC
  TTGAGCCCTGTCCCTGCGGCTGTGAGAGCAGCAGGACCCTGGGCCAGTTCCAGAGACCTGGGGGTGTGTC
  TGGGGGTGGGGTGTGAGTGCGTATGAAAGTGTGTGTCTGCTGGGGCAGCTGTGCCCCTGAATCATGGGCA
  CGGAGGGCCGCCCGCCACGCCCCGCGCTCAACTGCTCCCGTGGAAGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003952.2
• Summary: 'This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains a kinase catalytic domain and phosphorylates the S6 ribosomal protein and eukaryotic translation initiation factor 4B (eIF4B). Phosphorylation of S6 leads to an increase in protein synthesis and cell proliferation. [provided by RefSeq, Jan 2015]'
• Locus ID: 6199