LSM3 (NM_014463) Human 3' UTR Clone

CAT#: SC203130

3`UTR clone of LSM3 homolog U6 small nuclear RNA associated (S. cerevisiae) (LSM3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LSM3
• Synonyms: SMX4; USS2; YLR438C
• ACCN: NM_014463
• Insert Size: 277
• Sequence Data:
  Insert Sequence

  >SC203130 3'UTR clone of NM_014463
  The sequence shown below is from the reference sequence of NM_014463. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGATGGCGTTGTCCTGGTTGCCCCTCCACTGAGAGTTGGCTGAAACAAAGAATTTGTCCTGTATGGAAAA
  CGGGAGACTTTGTACAGTGGCCTCTCTAAAAGTACAAAACATTCATAAGAGAAACCTGCATACATTTTGA
  TATTAAGAAATAATTCCGGGGATTCTTCCACTCCTGAAATGAGTTGATTTGCAGATAACTCACAACTTCT
  TAAGCTAAATGGTATTTTCATTTTTCTCAAGCTCTCCAATAAATATGACCACCAAGATGCAGAACTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014463.2
• Summary: Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. [supplied by OMIM, Apr 2004]
• Locus ID: 27258