PSMB5 (NM_001130725) Human 3' UTR Clone

CAT#: SC203166

3`UTR clone of proteasome (prosome macropain) subunit beta type 5 (PSMB5) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PSMB5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PSMB5
Synonyms LMPX; MB1; X
ACCN NM_001130725
Insert Size 280 bp
Sequence Data
>SC203166 3'UTR clone of NM_001130725
The sequence shown below is from the reference sequence of NM_001130725. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGTGGCTGATCTACATGAGAAGTATAGTGGCTCTACCCCCTGAAAGAGGGTGGATGCAGCTGCTTGTGTT
TCTTGGGGTGACTGTCATTGGTAATACGGACACAGTGACCCATCCTCCATCCTATTTATAGTGGAAGGGC
CTTCAATTGTATCAGTACTTTTTTTTAAGCTCTGGCACATTGACCTCTATGTGTTACCAGTCATTAATGA
GCTGCTGCAGAGGTGACTATTTGTTTTACTTTCTTGGATGTTAACATTACACTACTCACTACTCAATCTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001130725.1
Summary 'The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit in the proteasome. This catalytic subunit is not present in the immunoproteasome and is replaced by catalytic subunit 3i (proteasome beta 8 subunit). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]'
Locus ID 5693

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.