Ku70 (XRCC6) (NM_001469) Human 3' UTR Clone

CAT#: SC203184

3`UTR clone of X-ray repair complementing defective repair in Chinese hamster cells 6 (XRCC6) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: XRCC6
• Synonyms: CTC75; CTCBF; G22P1; KU70; ML8; TLAA
• ACCN: NM_001469
• Insert Size: 234 bp
• Sequence Data:
  Insert Sequence

  >SC203184 3'UTR clone of NM_001469
  The sequence shown below is from the reference sequence of NM_001469. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCACCAAGCACTTCCAGGACTGACCAGAGGCCGCGCGTCCAGCTGCCCTTCCGCAGTGTGGCCAGGCTGC
  CTGGCCTTGTCCTCAGCCAGTTAAAATGTGTTTCTCCTGAGCTAGGAAGAGTCTACCCGACATAAGTCGA
  GGGACTTTATGTTTTTGAGGCTTTCTGTTGCCATGGTGATGGTGTAGCCCTCCCACTTTGCTGTTCCTTA
  CTTTACTGCCTGAATAAAGAGCCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001469.3
• Summary: 'The p70/p80 autoantigen is a nuclear complex consisting of two subunits with molecular masses of approximately 70 and 80 kDa. The complex functions as a single-stranded DNA-dependent ATP-dependent helicase. The complex may be involved in the repair of nonhomologous DNA ends such as that required for double-strand break repair, transposition, and V(D)J recombination. High levels of autoantibodies to p70 and p80 have been found in some patients with systemic lupus erythematosus. [provided by RefSeq, Jul 2008]'
• Locus ID: 2547