LYNX1 (NM_023946) Human 3' UTR Clone

CAT#: SC203362

3`UTR clone of Ly6/neurotoxin 1 (LYNX1) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "LYNX1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol LYNX1
Synonyms SLURP2
ACCN NM_023946
Insert Size 309
Sequence Data
>SC203362 3'UTR clone of NM_023946
The sequence shown below is from the reference sequence of NM_023946. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TATCCATCGCTTGCTGCCAGACCAGCCTCTGCAACCATGACTGACGGCTGCCCTCCTCCAGGCCCCCGGA
CGCTCAGCCCCCACAGCCCCCACAGCCTGGCGCCAGGGCTCACAGCTGCCCCTCCCTCGAGACTGGCCAG
CCCACCTCTCCCGGCCTCTGCAGCCACCGTCCAGCACCGCTTGTCCTAGGGAAGTCCTGCGTGGAGTCTT
GCCTCAATCTGCTGCCGTCCAAGCCTGGGGCCCATCGTGCCTGCCGCCCCTTCAGGTCCCGACCTCCCCA
CAATAAAATGTGATTGGATCGTGTGGTAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_023946.2
Summary This locus represents naturally occurring read-through transcription between the neighboring LYNX1 and SLURP2 genes. The readthrough transcript encodes a fusion protein comprised of sequence sharing identity with each individual gene product. The significance of this read-through transcription and the function of the resulting protein product have not yet been determined. [provided by RefSeq, Sep 2017]
Locus ID 66004

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.