CAD (NM_004341) Human 3' UTR Clone

CAT#: SC203380

3`UTR clone of carbamoyl-phosphate synthetase 2 aspartate transcarbamylase and dihydroorotase (CAD) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CAD
• Synonyms: CDG1Z; EIEE50; GATD4
• ACCN: NM_004341
• Insert Size: 299 bp
• Sequence Data:
  Insert Sequence

  >SC203380 3'UTR clone of NM_004341
  The sequence shown below is from the reference sequence of NM_004341. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TACATCCGCATGGCTCTGTTAGCCACCGTGCTGGGCCGTTTCTAGGGCCTGGCTTCCTCAGCCTCTTCTC
  TTTAGGCCCAGCTGCTGGGCAAGGAATTCCAGTGCCTCCTACGGGGGCAGCACACTTAGATATTCCTGGA
  CATCCAGATAGCTCACATGTGCTGACCACACTTCAGGCTCTGGACTGGAGCTCTCTGGCATGGGGGTGGG
  GCCTCAGATGCTGGGGCCCAGTCTGCCCCATCTTCATTCCTGCACCTTAAACCTGTACAGTCATTTTTCT
  ACTGACTTAATAAACAGCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004341.3
• Summary: 'The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]'
• Locus ID: 790