Cytochrome P450 2A6 (CYP2A6) (NM_000762) Human 3' UTR Clone

CAT#: SC203403

3`UTR clone of cytochrome P450 family 2 subfamily A polypeptide 6 (CYP2A6) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CYP2A6
• Synonyms: CPA6; CYP2A; CYP2A3; CYPIIA6; P450C2A; P450PB
• ACCN: NM_000762
• Insert Size: 285 bp
• Sequence Data:
  Insert Sequence

  >SC203403 3'UTR clone of NM_000762
  The sequence shown below is from the reference sequence of NM_000762. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTACACCATGAGCTTCCTGCCCCGCTGAGCGAGGGCTGTGCCGGTGCAGGTCTGGTGGGCGGGGCCAGGG
  AAAGGGCAGGGCCAAGACCGGGCTTGGGAGAGGGGCGCAGCTAAGACTGGGGGCAGGATGGCGGAAAGGA
  AGGGGCGTGGTGGCTAGAGGGAAGAGAAGAAACAGAAGCGGCTCAGTTCACCTTGATAAGGTGCTTCCGA
  GCTGGGATGAGAGGAAGGAAACCCTTACATTATGCTATGAAGAGTAGTAATAATAGCAGCTCTTATTTCC
  TGAGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000762.5
• Summary: 'This gene, CYP2A6, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to hydroxylate coumarin, and also metabolizes nicotine, aflatoxin B1, nitrosamines, and some pharmaceuticals. Individuals with certain allelic variants are said to have a poor metabolizer phenotype, meaning they do not efficiently metabolize coumarin or nicotine. This gene is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. The gene was formerly referred to as CYP2A3; however, it has been renamed CYP2A6. [provided by RefSeq, Jul 2008]'
• Locus ID: 1548