Eph receptor A6 (EPHA6) (NM_173655) Human 3' UTR Clone

CAT#: SC203413

3`UTR clone of EPH receptor A6 (EPHA6) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EPHA6
• Synonyms: EHK-2; EHK2; EK12; EPA6; HEK12; PRO57066
• ACCN: NM_173655
• Insert Size: 266
• Sequence Data:
  Insert Sequence

  >SC203413 3'UTR clone of NM_173655
  The sequence shown below is from the reference sequence of NM_173655. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGACCTCTTCCAAACTCTAACACTTAACCTCTGCTATTCTGCATAAATTCTGAGAAAAGCCAAATTTTC
  TGTCGGTCTAAGAAGACATAGCCTACACCCAACTGGAGATAATTATAAAAAATAATGAAGCAGCATGAGG
  GGAAGGTATTTAATGTGTATTTTAAAGTTGGGAGAGATTCTCCTTCACCTAATTTAGGTGTTTGTGAATT
  GGCTTGACTTTTTGAAGTTAATTTTTAAGCCTTGAACATGTCCAACTTTAAGAACT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_173655.2
• Summary: Receptor tyrosine kinase which binds promiscuously GPI-anchored ephrin-A family ligands residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling. [UniProtKB/Swiss-Prot Function]
• Locus ID: 285220